After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VSTM1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VSTM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_198481.3
RefSeq ORF Size:711bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set and transmembrane domain containing 1.
Gene Synonym:SIRL1, UNQ3033, MGC119160, MGC119161, VSTM1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

V-set and transmembrane domain containing 1 (VSTM1) is a protein containing the V-set domains. V-set domains are immunoglobulin-like domains resembling the antibody variable region. V-set domains are found in many kinds of protein families, including immunoglobulin light and heavy chains, several T-cells such as CD2, CD4, CD80, and CD86, myelin membrane adhesion molecules, junction adhesion molecules (JAM), tyrosine-protein kinase receptors, and the programmed cell death protein1.

References
  • Satow Y, et al. (1986) Phosphocholine binding immunoglobulin Fab McPC603. An X-ray diffraction study at 2.7 A. J Mol Biol. 190 (4): 593-604.
  • Rees DC, et al. (2009) ABC transporters: the power to change. Cell Biol. 10 (3): 218-227.
  • Size / Price
    Catalog: HG13171-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"