After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human BLVRB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BLVRB cDNA Clone Product Information
Gene_bank_ref_id:NM_000713.2
RefSeq ORF Size:621bp
cDNA Description:Full length Clone DNA of Homo sapiens biliverdin reductase B (flavin reductase (NADPH)).
Gene Synonym:FLR, BVRB, SDR43U1, MGC117413, BLVRB
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin, to bilirubin. BVR consists of an N-terminal dinucleotide-binding domain (Rossmann-fold) and a C-terminal domain that contains a six-stranded β-sheet that is flanked on one face by several α-helices. The C-terminal and N-terminal domains interact extensively, forming the active site cleft at their interface. Biliverdin reductase (BVR) catalyzes the last step in heme degradation by reducing the γ-methene bridge of the open tetrapyrrole, biliverdin IXα, to bilirubin with the concomitant oxidation of a β-nicotinamide adenine dinucleotide (NADH) or β-nicotinamide adenine dinucleotide phosphate (NADPH) cofactor. It is now recognized that human BVR (hBVR) is a dual-specificity kinase (Ser / Thr and Tyr) upstream activator of the insulin/insulin growth factor-1 (IGF-1) and mitogen-activated protein kinase (MAPK) signaling pathways. Human BVR (hBVR) is essential for MAPK-extracellular signal-regulated kinase (ERK)1/2 (MEK)-eukaryotic-like protein kinase (Elk) signaling and has been identified as the cytoplasm-nuclear heme transporter of ERK1/2 and hematin, the key components of stress-responsive gene expression.

References
  • Kapitulnik J, et al. (2009) Pleiotropic functions of biliverdin reductase: cellular signaling and generation of cytoprotective and cytotoxic bilirubin. Trends in Pharmacological Sciences. 30(3): 129-37.
  • Ahmad Z, et al. (2002) Human Biliverdin Reductase Is a Leucine Zipper-like DNA-binding Protein and Functions in Transcriptional Activation of Heme Oxygenase-1 by Oxidative Stress. The Journal of Biological Chemistry. 277: 9226-32.
  • Whitby FG, et al. (2002) Crystal Structure of a Biliverdin IX Reductase Enzyme-Cofactor Complex. Journal of Molecular Biology. 319(5): 1199-210.
  • Size / Price
    Catalog: HG13151-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"