Quick Order

Text Size:AAA

Human GFI1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GFI1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005263.3
RefSeq ORF Size:1269bp
cDNA Description:Full length Clone DNA of Homo sapiens growth factor independent 1 transcription repressor.
Gene Synonym:SCN2, GFI-1, ZNF163, FLJ94509, GFI1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-GFI1
Restriction Site:HindIII + XbaI (6.1kb + 1.27kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 465 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13131-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"