Quick Order

Text Size:AAA

Human ALDH3A1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALDH3A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001135168.1
RefSeq ORF Size:1362bp
cDNA Description:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 3 family, member A1.
Gene Synonym:ALDH3, ALDHIII, MGC10406, ALDH3A1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ALDH3A1
Restriction Site:KpnI + XbaI (6.1kb + 1.36kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Pappa A, et al. (2003) Human aldehyde dehydrogenase 3A1 (ALDH3A1): biochemical characterization and immunohistochemical localization in the cornea. Biochem J. 376(3): 615-23.
  • Estey T, et al. (2007) ALDH3A1: a corneal crystallin with diverse functions. Experimental Eye Research. 84(1):3-12.
  • Pappa A, et al. (2003) Aldh3a1 protects human corneal epithelial cells from ultraviolet- and 4-hydroxy-2-nonenal-induced oxidative damage. Free Radical Biology and Medicine. 34(9):1178-89.
  • Size / Price
    Catalog: HG13129-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"