After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ALDH3A1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALDH3A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001135168.1
RefSeq ORF Size:1362bp
cDNA Description:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 3 family, member A1.
Gene Synonym:ALDH3, ALDHIII, MGC10406, ALDH3A1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ALDH3A1
Restriction Site:KpnI + XbaI (6.1kb + 1.36kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Pappa A, et al. (2003) Human aldehyde dehydrogenase 3A1 (ALDH3A1): biochemical characterization and immunohistochemical localization in the cornea. Biochem J. 376(3): 615-23.
  • Estey T, et al. (2007) ALDH3A1: a corneal crystallin with diverse functions. Experimental Eye Research. 84(1):3-12.
  • Pappa A, et al. (2003) Aldh3a1 protects human corneal epithelial cells from ultraviolet- and 4-hydroxy-2-nonenal-induced oxidative damage. Free Radical Biology and Medicine. 34(9):1178-89.
  • Size / Price
    Catalog: HG13129-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"