Quick Order

Human TUBB3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TUBB3 cDNA Clone Product Information
Gene_bank_ref_id:NM_006086.3
RefSeq ORF Size:1353bp
cDNA Description:Full length Clone DNA of Homo sapiens tubulin, beta 3.
Gene Synonym:TUBB4, beta-4, CFEOM3A, TUBB3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TUBB3
Restriction Site:KpnI + XbaI (6.1kb + 1.35kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13121-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"