Quick Order

Human KRT14 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human KRT14 cDNA Clone Product Information
NCBI RefSeq:NM_000526.4
RefSeq ORF Size:1419bp
cDNA Description:Full length Clone DNA of Homo sapiens keratin 14.
Gene Synonym:K14, NFJ, CK14, EBS3, EBS4, KRT14
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Cytokeratin 14, also known as Keratin 14 and K14, is a member of the keratin family. Cytokeratin 14 is a type I keratin. It is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Cytokeratin 14 is mainly expressed in the basal layer. It is also strongly expressed in the outer root sheath of anagen follicles. Cytokeratin 14 and keratin 5 may have a role in maintenance of cell proliferation potential in the basal layer of stratified epithelia, modulating phosphatidylinositol 3-kinase/Akt–mediated cell proliferation and/or Notch1-dependent cell differentiation. Cytokeratin 14 defect prevents it from working effectively with keratin 5 and interfering with the assembly of the keratin intermediate filament network. A disruption in this network makes keratinocytes fragile and prone to rupture. Minor trauma to the skin, such as rubbing or scratching, can cause these cells to break down, resulting in the formation of painful, fluid-filled blisters. Mutations in the K14 gene are also responsible for Naegeli-Franceschetti-Jadassohn syndrome and dermatopathia pigmentosa reticularis.

References
  • Coulombe PA, et al., 1991, Cell. 66(6): 1301-11.
  • Schweizer J, et al., 2006, 174(2): 169-74.
  • Lugassy J, et al., 2006, Am J Hum Genet. 79(4): 724-30.
  • Size / Price
    Catalog: HG13109-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"