Quick Order

Human IL17Rb natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL17RB cDNA Clone Product Information
NCBI RefSeq:NM_018725.3
RefSeq ORF Size:1509bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 17 receptor B.
Gene Synonym:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-IL17RB
Restriction Site:HindIII + XbaI (6.1kb + 1.51kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations 126G/C and 369T/C, not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL17RB Gene Plasmid Map
Human IL17Rb Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Rhesus IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL-17RD Protein (Fc Tag)Rhesus IL17 / IL17a ProteinRhesus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Canine IL17RD Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Mouse IL25 Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL17RA / CD217 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Human IL-17F / Interleukin-17F Protein (His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman p38 delta / MAPK13 Protein (GST Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human IL17RC Protein (aa 1-454, His Tag)Human IL17RC Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17 / IL17A ProteinRat IL17RA / IL17R Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Rhesus IL17RA / IL17R Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Human IL17 / IL17A Protein (His Tag)Human IL-17F / IL17F ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)
References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catalog: HG13091-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"