After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PGA4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PGA4cDNA Clone Product Information
Gene_bank_ref_id:NM_001079808.1
cDNA Size:1167
cDNA Description:ORF Clone of Homo sapiens pepsinogen 4, group I (pepsinogen A) DNA.
Gene Synonym:PGA3, PGA5, FLJ58952, FLJ77962, PGA4
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

PGA4 (Pepsinogen 4, group I), or Pepsinogen A, is a member of the peptidase A1 family. Pepsin is expressed as a pro-form zymogen, pepsinogen, whose primary structure has an additional 44 amino acids. Pepsin is stored as pepsinogen so it will only be released when needed, and does not digest the body's own proteins in the stomach's lining. Five types of zymogens of pepsins, gastric digestive proteinases, are known: pepsinogens A, B, and F, progastricsin, and prochymosin. There are two major groups of pepsinogen, namely pepsinogen A (PGA) and pepsinogen C (PGC) (or progastricsin), and each frequently has isozymogens. The PGA3, PGA4 and PGA5 genes encode identical human pepsinogen A enzymes.

References
  • Kageyama T. (2002) Pepsinogens, progastricsins, and prochymosins: structure, function, evolution, and development. Cell Mol Life Sci. 59(2): 288-306.
  • Takahashi K. (1992) Gene structures of pepsinogens A and C. Scand J Clin Lab Invest Suppl. 210: 97-110.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"