Quick Order

Human GOLM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GOLM1cDNA Clone Product Information
cDNA Size:1206
cDNA Description:ORF Clone of Homo sapiens golgi membrane protein 1 DNA.
Gene Synonym:GP73, GOLPH2, C9orf155, FLJ22634, FLJ23608, PSEC0257, bA379P1.3, GOLM1
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Golgi membrane protein 1, also known as Golgi membrane protein GP73, Golgi phosphoprotein 2 and GOLM1, is a protein which belongs to the GOLM1 / CASC4 family. GOLM1 is widely expressed. It is highly expressed in colon, prostate, trachea and stomach. It is expressed at lower level in testis, muscle, lymphoid tissues, white blood cells and spleen. It is predominantly expressed by cells of the epithelial lineage. GOLM1 is expressed at low level in normal liver. Expression significantly increases in virus (HBV, HCV) infected liver. Expression of GOLM1 does not increase in liver disease due to non-viral causes (alcohol-induced liver disease, autoimmune hepatitis). Increased expression in hepatocytes appears to be a general feature of advanced liver disease. In liver tissue from patients with adult giant-cell hepatitis (GCH), GOLM1 is strongly expressed in hepatocyte-derived syncitial giant cells. GOLM1 is constitutively expressed by biliary epithelial cells but not by hepatocytes.