After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IGFII / IGF2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IGF2 cDNA Clone Product Information
NCBI RefSeq:NM_000612.4
RefSeq ORF Size:543bp
cDNA Description:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 (somatomedin A).
Gene Synonym:PP1446, C11orf43, FLJ22066, FLJ44734, IGF-II, PP9974
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-IGF2
Restriction Site:KpnI + XbaI (6.1kb + 0.54kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IGF2 Gene Plasmid Map
Human IGFII / IGF2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Background

Insulin-like growth factor 2 (IGF-2/IGF-II) is a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. IGF-2/IGF-II is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland. IGF-2 and exhibited statistically significant, positive associations with colorectal cancer risk when cases were confined to those diagnosed within a relatively short time period after enrolment. Circulating IGF-2 and IGFBP-3 can serve as early indicators of impending colorectal cancer. IGF-2/IGF-II appears to be involved in the progression of many tumours. It binds to at least two different types of receptor: IGF type 1 (IGF 1R) and mannose 6-phosphate/IGF type 2 (M6-P/IGF 2R). Ligand binding to IGF 1R provokes mitogenic and anti-apoptotic effects. M6-P/IGF 2R has a tumour suppressor function—it mediates IGF 2 degradation. Mutation of M6-P/IGF 2R causes both diminished growth suppression and augmented growth stimulation. The aim of this study was to investigate the role of IGF 2 and its receptors (IGF 1R and IGF 2R) in human gastric cancer.

References
  • Harvey MB, et al. (1991) IGF-2 receptors are first expressed at the 2-cell stage of mouse development. Development. 111(4): 1057-60.
  • Peters G, et al. (2003) IGF-1R, IGF-1 and IGF-2 expression as potential prognostic and predictive markers in colorectal-cancer. Virchows Arch. 443(2): 139-45.
  • Burrow S, et al. (1998) Expression of insulin-like growth factor receptor, IGF-1, and IGF-2 in primary and metastatic osteosarcoma. J Surg Oncol. 69(1): 21-7.
  • Size / Price
    Catalog: HG13032-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"