Quick Order

Human PDE2A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDE2AcDNA Clone Product Information
cDNA Size:2826
cDNA Description:ORF Clone of Homo sapiens phosphodiesterase 2A, cGMP-stimulated DNA.
Gene Synonym:PDE2A1, PED2A4, PDE2A
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

cGMP-dependent 3',5'-cyclic phosphodiesterase, also known as cyclic GMP-stimulated phosphodiesterase and PDE2A, is a peripheral membrane protein which belongs to the cyclic nucleotide phosphodiesterase family and PDE2 subfamily. Phosphodiesterases (PDEs) comprise a family of enzymes that regulate the levels of cyclic nucleotides, key second messengers that mediate a diverse array of functions. Phosphodiesterases (PDEs) modulate signaling by cyclic nucleotides in diverse processes such as cardiac contractility, platelet aggregation, lipolysis, glycogenolysis, and smooth muscle contraction. PDE2A is an evolutionarily conserved cGMP-stimulated cAMP and cGMP PDE. PDE2A contains two GAF domains. PDE2A is expressed in brain and to a lesser extent in heart, placenta, lung, skeletal muscle, kidney and pancreas. PDE2A is a cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes. PDE2A is involved in the regulation of blood pressure and fluid homeostasis by the atrial natriuretic peptide (ANP), making PDE2-type enzymes important targets for drug discovery.

  • Iffland,A. et al., 2005, Biochemistry. 44 (23):8312-25
  • de Oliveira,S.K. et al., 2007,J Biol Chem. 282 (18):13656-63.
  • Stephenson,D.T. et al., 2009, J Histochem Cytochem. 57 (10):933-49.
  • Russwurm,C. et al., 2009, J Biol Chem. 284 (38):25782-90.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items