Quick Order

Text Size:AAA

Human SLCO1B3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SLCO1B3 cDNA Clone Product Information
Gene_bank_ref_id:BC141525
RefSeq ORF Size:2109bp
cDNA Description:Full length Clone DNA of Homo sapiens solute carrier organic anion transporter family, member 1B3.
Gene Synonym:LST3, OATP8, OATP1B3, SLC21A8, LST-3TM13, SLCO1B3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SLCO1B3
Restriction Site:KpnI (two restriction sites) + XbaI (6.11kb+1.66kb+0.45kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13013-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"