Quick Order

Text Size:AAA

Human ARNT transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ARNT cDNA Clone Product Information
Gene_bank_ref_id:NM_001668.2
RefSeq ORF Size:2370bp
cDNA Description:Full length Clone DNA of Homo sapiens aryl hydrocarbon receptor nuclear translocator, transcript variant 1.
Gene Synonym:HIF1B, TANGO, bHLHe2, HIF1BETA, HIF-1beta, ARNT
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ARNT
Restriction Site:HindIII + XbaI (6.1kb + 2.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 G>A , 567 G>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ARNT Gene Plasmid Map
Human ARNT transcript variant 1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG13010-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"