Quick Order

Human EZR natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EZR cDNA Clone Product Information
Gene_bank_ref_id:NM_001111077.1
RefSeq ORF Size:1761bp
cDNA Description:Full length Clone DNA of Homo sapiens ezrin.
Gene Synonym:CVL, CVIL, VIL2, HEL-S-105
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

VIL2, also known as villin-2, belongs to the ERM protein family. It is expressed in cerebral cortex, basal ganglia, hippocampus, hypophysis, and optic nerve. VIL2 contains 1 FERM domain and may be involved in connections of major cytoskeletal structures to the plasma membrane. It plays a key role in cell surface structure adhesion, migration, and organization. In epithelial cells, VIL2 is required for the formation of microvilli and membrane ruffles on the apical pole. It interacts with MPP5 and SLC9A3R2. It is found VIL2 form a complex with PODXL and SLC9A3R2. It also interacts with MCC, PLEKHG6, PODXL, SCYL3/PACE1, SLC9A3R1 and TMEM8B.

References
  • Grnholm M, et al. (1999) Homotypic and heterotypic interaction of the neurofibromatosis 2 tumor suppressor protein merlin and the ERM protein ezrin. J Cell Sci. 112(6):895-904.
  • Sitaraman, et al. (2002) The adenosine 2b receptor is recruited to the plasma membrane and associates with E3KARP and Ezrin upon agonist stimulation. J Biol Chem. 277(36):33188-95.
  • Gould KL, et al. (1989) cDNA cloning and sequencing of the protein-tyrosine kinase substrate, ezrin, reveals homology to band 4.1. EMBO J. 8(13):4133-42.
  • Size / Price
    Catalog: HG12858-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"