Quick Order

Human TXN2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TXN2cDNA Clone Product Information
Gene_bank_ref_id:BC013726
cDNA Size:501
cDNA Description:ORF Clone of Homo sapiens thioredoxin 2 DNA.
Gene Synonym:MTRX, TRX2, MT-TRX
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

References
  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Catalog:HG12557-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"