Quick Order

Human S1PR1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human S1PR1 cDNA Clone Product Information
NCBI RefSeq:NM_001400.4
RefSeq ORF Size:1149bp
cDNA Description:Full length Clone DNA of Homo sapiens sphingosine-1-phosphate receptor 1.
Gene Synonym:EDG1, S1P1, CD363, ECGF1, EDG-1, CHEDG1, D1S3362
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-S1PR1
Restriction Site:HindIII + XbaI (6.1kb + 1.15kb)
Tag Sequence:
Sequence Description: Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG12413-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"