After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDK1cDNA Clone Product Information
cDNA Size:1311
cDNA Description:ORF Clone of Homo sapiens pyruvate dehydrogenase kinase, isozyme 1 DNA.
Gene Synonym:PDK1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Pyruvate dehydrogenase kinase, isozyme 1, also known as [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitochondrial and PDK1, is a member of the PDK / BCKDK protein kinase family. PDK-1 is expressed predominantly in the heart. It contains one histidine kinase domain. Pyruvate dehydrogenase kinase (PDK) isoforms are molecular switches that downregulate the pyruvate dehydrogenase complex (PDC) by reversible phosphorylation in mitochondria. An inhibitory effect of lipoic acid on PDKs would result in less phosphorylation of E1 and hence increased PDC activity. At least two isoenzymic forms of pyruvate dehydrogenase kinase ( PDK-1 and PDK-2 ) may be involved in the regulation of enzymatic activity of mammalian pyruvate dehydrogenase complex by phosphorylation. PDK-3 appears to have the highest specific activity among the three isoenzymes. PDK-1 inhibits the mitochondrial pyruvate dehydrogenase complex by phosphorylation of the E1 alpha subunit, thus contributing to the regulation of glucose metabolism.

  • Gudi R., et al., 1995, J. Biol. Chem. 270:28989-94.
  • Mooney,B.P. et al., 2000, Biochem Biophys Res Commun. 267 (2): 500 - 503.
  • Korotchkina,L.G. et al., 2004, Free Radic Res. 38 (10):1083-92.
  • Kato M., et al., 2007, Structure 15: 992-1004.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items