Quick Order

Text Size:AAA

Human SECTM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SECTM1cDNA Clone Product Information
cDNA Size:747
cDNA Description:ORF Clone of Homo sapiens secreted and transmembrane 1 DNA.
Gene Synonym:K12, SECTM1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Secreted and transmembrane 1 (SECTM1), also known as K12, is a transmembrane and secreted protein with characteristics of a type 1a transmembrane protein of SECTM family. It is found in a perinuclear Golgi-like pattern and thought to be involved in hematopoietic and/or immune system processes. The human K12 protein has been shown to be primarily expressed in spleen, prostate, testis, small intestine, and in peripheral blood leukocytes. The K12 protein is expressed on the cell surface in such small amounts as to preclude detection. Alternatively, it may be that K12 on the cell surface is rapidly cleaved to generate a soluble K12 protein. Immunohistochemical analysis of peripheral blood cells shows that K12 is found in leukocytes of the myeloid lineage, with the strongest staining observed in granulocytes and no detectable expression in lymphocytes. May be involved in thymocyte signaling. It had been suggested a role for thymic microenvironment-produced K12 in regulation of thymocyte signaling and cytokine release, particularly in the setting of thymus pathology where IFN-gamma is upregulated such as myasthenia gravis. In addition, as a putative natural CD7 ligand, SECTM1/K12 may be responsible for the costimulatory role it plays in T cell activation.

  • Leta E, et al. (1995) Production and characterization of the extracellular domain of human CD7 antigen: further evidence that CD7 has a role in T cell signaling. Cell Immunol. 165(1): 101-9.
  • Slentz-Kesler KA, et al. (1998) Identification and characterization of K12 (SECTM1), a novel human gene that encodes a Golgi-associated protein with transmembrane and secreted isoforms. Genomics. 47(3): 327-40.
  • Lyman SD, et al. (2000) Identification of CD7 as a cognate of the human K12 (SECTM1) protein. J Biol Chem. 275(5): 3431-7.
  • Lam GK, et al. (2005) Expression of the CD7 ligand K-12 in human thymic epithelial cells: regulation by IFN-gamma. J Clin Immunol. 25(1): 41-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items