After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KRAS natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KRAS cDNA Clone Product Information
NCBI RefSeq:BC013572
RefSeq ORF Size:507bp
cDNA Description:Full length Clone DNA of Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homol.
Gene Synonym:NS, NS3, KRAS1, KRAS2, RASK2, KI-RAS, C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-KRAS
Restriction Site:HindIII + NotI (6.1kb + 0.51kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human KRAS Gene Plasmid Map
Human KRAS Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

K-Ras belongs to the small GTPase superfamily, Ras family. As other members of the Ras family, K-Ras is a GTPase and is an early player in many signal transduction pathways. It is usually tethered to cell membranes because of the presence of an isoprenyl group on its C-terminus. K-Ras functions as a molecular on/off switch. Once it is turned on it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal, such as c-Raf and PI 3-kinase. It binds to GTP in the active state and possesses an intrinsic enzymatic activity which cleaves the terminal phosphate of the nucleotide converting it to GDP. Upon conversion of GTP to GDP, K-Ras is turned off. The rate of conversion is usually slow but can be sped up dramatically by an accessory protein of the GTPase activating protein class, for example RasGAP. In turn K-Ras can bind to proteins of the Guanine Nucleotide Exchange Factor class, for example SOS1, which forces the release of bound nucleotide. Subsequently, K-Ras binds GTP present in the cytosol and the GEF is released from ras-GTP. Besides essential function in normal tissue signaling, the mutation of a K-Ras gene is an essential step in the development of many cancers. Several germline K-Ras mutations have been found to be associated with Noonan syndrome[4] and cardio-facio-cutaneous syndrome. Somatic K-Ras mutations are found at high rates in Leukemias, colon cancer, pancreatic cancer and lung cancer.

References
  • Ling J, et al. (2012) KrasG12D-induced IKK2//NF-B activation by IL-1 alpha and p62 feedforward loops is required for development of pancreatic ductal adenocarcinoma. Cancer Cell. 21(1):105-20.
  • Matallanas D, et al. (2011) Mutant K-Ras activation of the proapoptotic MST2 pathway is antagonized by wild-type K-Ras. Mol Cell. 44(6):893-906.
  • Regala RP, et al. (2011) Matrix metalloproteinase-10 promotes Kras-mediated bronchio-alveolar stem cell expansion and lung cancer formation. PLoS One. 6(10):e26439.
  • Size / Price
    Catalog: HG12259-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"