After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SRPK1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SRPK1 cDNA Clone Product Information
NCBI RefSeq:BC038292
RefSeq ORF Size:1968bp
cDNA Description:Full length Clone DNA of Homo sapiens SFRS protein kinase 1.
Gene Synonym:SFRSK1, SRPK1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Serine / threonine-protein kinase SRPK1, also known as SFRS protein kinase 1, Serine/arginine-rich protein-specific kinase 1, SR-protein-specific kinase 1 and SRPK1, is a cytoplasm and nucleus protein which belongs to the protein kinase superfamily and CMGC Ser/Thr protein kinase family. Isoform 2 of SRPK1 is predominantly expressed in the testis but is also present at lower levels in heart, ovary, small intestine, liver, kidney, pancreas and skeletal muscle. Isoform 1 of SRPK1 is only seen in the testis, at lower levels than isoform 2. SRPK1 hyperphosphorylates RS domain-containing proteins such as SFRS1, SFRS2 and ZRSR2 on serine residues during metaphase but at lower levels during interphase. SRPK1 plays a central role in the regulatory network for splicing, controlling the intranuclear distribution of splicing factors in interphase cells and the reorganization of nuclear speckles during mitosis. SRPK1 locks onto SFRS1 to form a stable complex and processively phosphorylates the RS domain. SRPK1 appears to mediate HBV core protein phosphorylation which is a prerequisite for pregenomic RNA encapsidation into viral capsids.

References
  • Ngo J.C.K. et al., 2005, Mol. Cell 20:77-89.
  • Krishnakumar,S. et al., 2008, Pediatr Blood Cancer 50 (2):402-6.
  • Ma,C.T. et al., 2009, J Mol Biol  390 (4):618-34.
  • Souki S.K. et al., 2009, J. Virol. 83:8970-8975.
  • Choudhary C. et al., 2009, Science 325:834-840. 
  • Size / Price
    Catalog: HG12249-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"