Quick Order

Text Size:AAA

Human CD33 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD33cDNA Clone Product Information
cDNA Size:1095
cDNA Description:ORF Clone of Homo sapiens CD33 molecule DNA.
Gene Synonym:p67, SIGLEC3, SIGLEC-3
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3, is a member of the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. This Single-pass type I membrane protein contains 1 Ig-like C2-type (immunoglobulin-like) domain and 1 Ig-like V-type (immunoglobulin-like) domain. CD33 /Siglec-3 is a putative adhesion molecule of myelomonocytic-derived cells that mediates sialic-acid dependent binding to cells. CD33 /Siglec-3 preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. CD33/Siglec-3 induces apoptosis in acute myeloid leukemia (in vitro). CD33/Siglec-3 can function as a sialic acid-dependent cell adhesion molecule and that binding can be modulated by endogenous sialoglycoconjugates when CD33 is expressed in a plasma membrane.

  • Simmons D, et al. (1988) Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. J Immunol. 141(8): 2797-800.
  • Ulyanova T, et al. (1999) The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. Eur J Immunol. 29(11): 3440-9.
  • Freeman SD, et al. (1995) Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 85(8): 2005-12.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days