Quick Order

Text Size:AAA

Human CD44 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD44 cDNA Clone Product Information
Gene_bank_ref_id:BC004372
RefSeq ORF Size:2100bp
cDNA Description:Full length Clone DNA of Homo sapiens CD44 molecule (Indian blood group).
Gene Synonym:IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1, CDW44, CSPG8, HCELL, HUTCH-I, ECMR-III, CD44
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CD44
Restriction Site:KpnI + XbaI (6.1kb + 2.1kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD44 is a type I transmembrane protein and a member of the cartilage link protein family. It is involved in cell-cell and cell-matrix interactions and signal transduction. Several CD44 ligands have been identified. The most extensively characterized ligand for CD44 is hyaluronan, a component of the extracellular matrix. CD44 protein is expressed on the majority of immune cells. The binding of CD44 to hyaluronan is induced on T lymphocytes after activation by antigen and on monocytes after stimulation by inflammatory agents. Under inflammatory conditions, CD44 on endothelial cells presents hyaluronan to CD44 on activated T lymphocytes and mediates a rolling interaction under flow conditions. Perturbations of the hyaluronan-CD44 interaction at the plasma membrane by various antagonists result in attenuation of receptor tyrosine kinase and transporter activities and inhibition of tumor progression in vivo. CD44 is known to interact with the ezrin family (ERM family) members and form a complex that plays diverse roles within both normal and abnormal cells, particularly cancer cells. CD44 and ezrin and their respective complex have properties suggesting that they may be important in the process of tumour-endothelium interactions, cell migrations, cell adhesion, tumour progression and metastasis.

References
  • Bajorath J. (2000) Molecular organization, structural features, and ligand binding characteristics of CD44, a highly variable cell surface glycoprotein with multiple functions. Proteins. 39(2): 103-11.
  • Johnson P, et al. (2000) A role for the cell adhesion molecule CD44 and sulfation in leukocyte-endothelial cell adhesion during an inflammatory response? Biochem Pharmacol. 59(5): 455-65.
  • Martin TA, et al. (2003) The role of the CD44/ezrin complex in cancer metastasis. Crit Rev Oncol Hematol. 46(2): 165-86.
  • Toole BP, et al. (2008) Hyaluronan, CD44 and Emmprin: partners in cancer cell chemoresistance. Drug Resist Updat. 11(3): 110-21.
  • Johnson P, et al. (2009) CD44 and its role in inflammation and inflammatory diseases. Inflamm Allergy Drug Targets. 8(3): 208-20.
  • Size / Price
    Catalog: HG12211-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"