Quick Order

Text Size:AAA

Human ARAF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ARAFcDNA Clone Product Information
Gene_bank_ref_id:BC002466
cDNA Size:1821
cDNA Description:ORF Clone of Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog DNA.
Gene Synonym:PKS2, A-RAF, ARAF1, RAFA1, ARAF
Species:Human
Vector:pCMV3-untagged
Restriction Site:HindIII + NotI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
Catalog:HG12209-UT
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
Images
  • Human ARAF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"