Quick Order

Text Size:AAA

Human STK16 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human STK16 cDNA Clone Product Information
Gene_bank_ref_id:BC002618
RefSeq ORF Size:918bp
cDNA Description:Full length Clone DNA of Homo sapiens serine/threonine kinase 16.
Gene Synonym:KRCT, MPSK, TSF1, PKL12, STK16
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Serine/threonine-protein kinase 16, also known as myristoylated and palmitoylated serine/threonine-protein kinase, Protein kinase PKL12, TGF-beta-stimulated factor 1, TSF-1, MPSK1 and STK16, is a membrane protein which is ubiquitously expressed at very low levels. STK16 / MPSK1 belongs to the protein kinase superfamily and Ser/Thr protein kinase family. It contains one protein kinase domain. Transforming growth factor-beta (TGF-beta) shows a variety of biological activities in various organs or cells. Some factors such as Smads (Sma and Mad proteins) and TGF-beta activating kinase 1 have been characterized as signalling molecules downstream of TGF-beta. Several TGF-beta response elements have been identified such as cAMP response element, Smad binding element, and recognition sites for activating protein-1 and stimulating protein-1 in various gene promoters. STK16 / MPSK1 is an unique factor with two biological functions, transcriptional regulation and protein phosphorylation, that may be involved in TGF-beta signals. STK16 / MPSK1 is a protein kinase that act on both serine and threonine residues. STK16 / MPSK1 possessed DNA-binding ability and activated the TGF-beta responsive CNP promoter or vascular endothelial growth factor gene promoter which possesses a sequence element analogous to the TGF-beta responsive GC-rich element of the CNP promoter. STK16 / MPSK1 did not directly activate a Smads-dependent promoter from plasminogen activator inhibitor 1 gene, but it showed enhancement in co-operation with Smad3 and Smad4. STK16 / MPSK1 mRNA as well as its protein level were stimulated by TGF-beta treatment.

References
  • Ligos J.M., et al., 1998, Biochem. Biophys. Res.Commun. 249:380-4.
  • Berson A.E., et al.,1999, Biochem. Biophys. Res. Commun. 259:533-8.
  • Ohta S., et al., 2000, Biochem. J. 350:395-404.
  • Guinea,B. et al., 2006, Exp Cell Res. 312 (2):135-44. 
  • Size / Price
    Catalog: HG12201-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"