Quick Order

Text Size:AAA

Human COQ7 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
COQ7cDNA Clone Product Information
Gene_bank_ref_id:BC003185
cDNA Size:654
cDNA Description:ORF Clone of Homo sapiens coenzyme Q7 homolog, ubiquinone (yeast) DNA.
Gene Synonym:CAT5, CLK1, CLK-1, COQ7
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Ubiquinone biosynthesis protein COQ7 homolog, also known as Coenzyme Q biosynthesis protein 7 homolog, Timing protein clk-1 homolog and COQ7, is a mitochondrion inner membrane and peripheral membrane protein which belongs to the COQ7 family. It is expressed dominantly in heart and skeletal muscle. COQ7 is synthesized as a preprotein that is imported into the mitochondrial matrix, where the sequence is cleaved off and the mature protein becomes loosely associated with the inner membrane. This enzyme is responsible for the hydroxylation of 5-demethoxyubiquinone to 5-hydroxyubiquinone. Human COQ7 protein is mostly helical, and contains an alpha-helical membrane insertion. It has a potential N-glycosylation site, a phosphorylation site for protein kinase C and another for casein kinase II, and three N-myristoylation sites. COQ7 is involved in lifespan determination in ubiquinone-independent manner. It is also involved in ubiquinone biosynthesis. COQ7 is potential central metabolic regulator.

References
  • Ewbank J.J., et al., 1997, Science. 275: 980-3.
  • Vajo Z., et al., 1999, Mamm. Genome. 10: 1000-4.
  • Wiemann S., et al., 2001, Genome Res. 11: 422-35.
  • Stenmark,P. et al., 2001, J Biol Chem. 276 (36): 33297-300.
  • Martin J., et al., 2004, Nature. 432: 988-94. 
  • Size / Price
    Catalog:HG12195-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"