Quick Order

Text Size:AAA

Human CD99 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD99 cDNA Clone Product Information
Gene_bank_ref_id:BC002584
RefSeq ORF Size:558bp
cDNA Description:Full length Clone DNA of Homo sapiens CD99 molecule.
Gene Synonym:MIC2, HBA71, MIC2X, MIC2Y, MSK5X, CD99
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD99 is a transmembrane protein expressed on most hematopoietic cells, endothelial cells and at the borders between confluent cells. CD99 is also found expressed in the development of normal ovary and testis as well as in 25 sex cord-stromal tumors, 7 epithelial neoplasms, and 6 germ cell tumors. CD99 may be a useful marker for sex cord-stromal tumors and that its degree of reactivity correlates with the degree of differentiation in Sertoli-Leydig cell tumors. Additionally, CD99 might aid in distinguishing granulose cell tumors of the ovary from poorly differentiated carcinomas and it has been reported to be a sensitive and specific marker for Ewing's sarcoma and primitive neuroectodermal tumor.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Schenkel AR, et al. (2002) CD99 plays a major role in the migration of monocytes through endothelial junctions. Nature Immunology. 3: 143 - 50.
  • Gordon MD, et al. (1998) CD99, keratin, and vimentin staining of sex cord-stromal tumors, normal ovary, and testis. Mod Pathol. 11 (8): 769-73.
  • Size / Price
    Catalog: HG12193-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"