Quick Order

Human PTP4A3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTP4A3 cDNA Clone Product Information
NCBI RefSeq:BC003105
RefSeq ORF Size:447bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase type IVA, member 3.
Gene Synonym:PRL3, PRL-3, PRL-R, PTP4A3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PTP4A3
Restriction Site:KpnI + XbaI (6.1kb + 0.45kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PTP4A3 Gene Plasmid Map
Human PTP4A3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG12189-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"