After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RARAcDNA Clone Product Information
cDNA Size:1389
cDNA Description:ORF Clone of Homo sapiens retinoic acid receptor, alpha, transcript variant 1 DNA.
Gene Synonym:RAR, NR1B1, RARA
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12119-ACG$325
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12119-ACR$325
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12119-ANG$325
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12119-ANR$325
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12119-CF$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12119-CH$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12119-CM$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12119-CY$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG12119-M$95
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12119-M-N$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12119-NF$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12119-NH$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12119-NM$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12119-NY$295
Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12119-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
  • Human RARA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items