Quick Order

Human ITGB1BP1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ITGB1BP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_004763.3
RefSeq ORF Size:603bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin beta 1 binding protein 1.
Gene Synonym:ICAP1, ICAP1A, ICAP1B, ICAP-1A, ICAP-1B, ICAP-1alpha, DKFZp686K08158, ITGB1BP1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ITGB1BP1
Restriction Site:KpnI + XbaI (6.1kb + 0.6kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB1BP1 Gene Plasmid Map
Human ITGB1BP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG12118-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"