After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HNF4A transcript variant 3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HNF4A cDNA Clone Product Information
NCBI RefSeq:NM_178850
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Homo sapiens hepatocyte nuclear factor 4, alpha, transcript variant 3.
Gene Synonym:TCF, HNF4, MODY, MODY1, NR2A1, TCF14, HNF4a7, HNF4a8, HNF4a9, NR2A21, FLJ39654, HNF4alpha, HNF4A
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HNF4A
Restriction Site:KpnI + XbaI (6.1kb + 1.25kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG12105-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"