After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TNFAIP3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TNFAIP3 cDNA Clone Product Information
NCBI RefSeq:NM_006290.2
RefSeq ORF Size:2373bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor, alpha-induced protein 3.
Gene Synonym:A20, OTUD7C, TNFA1P2, MGC104522, MGC138687, MGC138688, TNFAIP3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TNFAIP3
Restriction Site:KpnI + XbaI (6.1kb + 2.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TNFAIP3 Gene Plasmid Map
Human TNFAIP3 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG12089-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"