After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RGMA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RGMA cDNA Clone Product Information
Gene_bank_ref_id:NM_020211
RefSeq ORF Size:1227bp
cDNA Description:Full length Clone DNA of Homo sapiens RGM domain family, member A.
Gene Synonym:RGM
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

RGMa, also known as RGM domain family, member A, belongs to the RGM (repulsive guidance molecule) family whose members are membrane-associated glycoprotein. RGMa is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. It helps guide Retinal Ganglion Cell (RGC) axons to the tectum in the midbrain. RGMa has been implicated to play an important role in the developing brain and in the scar tissue that forms after a brain injury. This protein may also function as a tumor suppressor in some cancers.

References
  • Severyn CJ, et al. (2009). Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. Biochem J. 422 (3): 393-403.
  • Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature. 419: 392-5.
  • Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology. 6: 749-55.
  • Size / Price
    Catalog: HG12086-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"