Quick Order

Text Size:AAA

Human MECP2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MECP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_004992
RefSeq ORF Size:1461bp
cDNA Description:Full length Clone DNA of Homo sapiens methyl CpG binding protein 2 (Rett syndrome).
Gene Synonym:MECP2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MECP2
Restriction Site:KpnI + XbaI (6.1kb + 1.46kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MECP2 Gene Plasmid Map
Human MECP2 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG12052-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"