After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human HEXA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HEXA cDNA Clone Product Information
Gene_bank_ref_id:NM_000520
RefSeq ORF Size:1590bp
cDNA Description:Full length Clone DNA of Homo sapiens hexosaminidase A (alpha polypeptide).
Gene Synonym:HEXA
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catalog: HG12037-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"