Quick Order

Human SSTR2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SSTR2 cDNA Clone Product Information
NCBI RefSeq:NM_001050.2
RefSeq ORF Size:1110bp
cDNA Description:Full length Clone DNA of Homo sapiens somatostatin receptor 2.
Gene Synonym:SSTR2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SSTR2
Restriction Site:HindIII + XbaI (6.1kb + 1.11kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SSTR2 Gene Plasmid Map
Human SSTR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"