Quick Order

Human LUM Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LUMcDNA Clone Product Information
cDNA Size:1017
cDNA Description:ORF Clone of Homo sapiens lumican DNA.
Gene Synonym:LDC, SLRR2D, LUM
Restriction Site:KpnI(two) + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Lumican, a prototypic leucine-rich proteoglycan with keratan sulfate side chains, is a major component of the cornea, dermal, and muscle connective tissues. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican regulates collagenous matrix assembly as a keratan sulfate proteoglycan in the cornea and is also present in the connective tissues of other organs and embryonic corneal stroma as a glycoprotein. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. lumican expressed in injured epithelium may modulate cell behavior such as adhesion or migration, thus contributing to corneal epithelial wound healing. Lumican plays a crucial role in the regulation of collagen assembly into fibrils in various connective tissues and serve as a definitive link between a necessity for lumican in the development of a highly organized collagenous matrix and corneal transparency.

  • Saika S, et al. (2000) Role of lumican in the corneal epithelium during wound healing. J Biol Chem. 275(4): 2607-12.
  • Chakravarti S, et al. (1998) Lumican regulates collagen fibril assembly: skin fragility and corneal opacity in the absence of lumican. J Cell Biol. 141(5): 1277-86.
  • Ezura Y, et al. (2000) Differential expression of lumican and fibromodulin regulate collagen fibrillogenesis in developing mouse tendons. J Cell Biol. 151(4): 779-88.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human LUM Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items