After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CAPZA1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CAPZA1 cDNA Clone Product Information
Gene_bank_ref_id:NM_006135.2
RefSeq ORF Size:861bp
cDNA Description:Full length Clone DNA of Homo sapiens capping protein (actin filament) muscle Z-line, alpha 1.
Gene Synonym:CAPZ, CAZ1, CAPPA1, CAPZA1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CAPZA1
Restriction Site:KpnI + XbaI (6.1kb + 0.86kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CAPZA1 Gene Plasmid Map
Human CAPZA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11631-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"