After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AGERcDNA Clone Product Information
Gene_bank_ref_id:NM_001136.3
cDNA Size:1215
cDNA Description:ORF Clone of Homo sapiens advanced glycosylation end product-specific receptor, transcript variant 1 DNA.
Gene Synonym:RAGE, MGC22357, AGER
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11629-ACG$325
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11629-ACR$325
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11629-CF$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11629-CH$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11629-CM$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11629-CY$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG11629-M$95
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11629-M-N$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11629-NF$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11629-NH$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11629-NM$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11629-NY$295
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11629-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Receptor for Advanced Glycosylation End Products (RAGE, or AGER) is a member of the immunoglobulin super-family transmembrane proteins, as a signal transduction receptor which binds advanced glycation endproducts, certain members of the S100/calgranulin family of proteins, high mobility group box 1 (HMGB1), advanced oxidation protein products, and amyloid (beta-sheet fibrils). Initial studies investigating the role of RAGE in renal dysfunction focused on diabetes, neurodegenerative disorders, and inflammatory responses. However, RAGE also has roles in the pathogenesis of renal disorders that are not associated with diabetes, such as obesity-related glomerulopathy, doxorubicin-induced nephropathy, hypertensive nephropathy, lupus nephritis, renal amyloidosis, and ischemic renal injuries. RAGE represents an important factor in innate immunity against pathogens, but it also interacts with endogenous ligands, resulting in chronic inflammation. RAGE signaling has been implicated in multiple human illnesses, including atherosclerosis, arthritis, Alzheimer's disease, atherosclerosis and aging associated diseases.

References
  • Zhou Z, et al. (2011) RAGE and its ligands in bone metabolism. Front Biosci (Schol Ed). 3: 768-76.
  • Mosquera JA. (2010) Role of the receptor for advanced glycation end products (RAGE) in inflammation]. Invest Clin. 51(2): 257-68.
  • D'Agati V, et al. (2010) RAGE and the pathogenesis of chronic kidney disease. Nat Rev Nephrol. 6(6): 352-60.
  • Size / Price
    Catalog:HG11629-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"