Quick Order

Text Size:AAA

Human PCBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PCBP1cDNA Clone Product Information
cDNA Size:1071
cDNA Description:ORF Clone of Homo sapiens poly(rC) binding protein 1 DNA.
Gene Synonym:HNRPX, HNRPE1, hnRNP-X, hnRNP-E1, PCBP1
Restriction Site:KpnI + NotI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Poly(rC)-binding protein 1, also known as Heterogeneous nuclear ribonucleoprotein E1, Alpha-CP1, Nucleic acid-binding protein SUB2.3 and PCBP1, is a family member of heterogeneous nuclear ribonucleoproteins (hnRNPs) that belong to RNA-binding proteins and bear three KH domains. PCBP1 is loosely bound in the nucleus. It may shuttle between the nucleus and the cytoplasm. It is abundantly expressed in skeletal muscle, thymus and peripheral blood leukocytes while a lower expression is observed in prostate, spleen, testis, ovary, small intestine, heart, liver, adrenal and thyroid glands. PCBP1 is widely expressed in many human tissues and involved in regulation of transcription, transportation process, and function of RNA molecules. PCBP1 plays a pivotal role in post-transcriptional regulation for RNA metabolism and RNA function in gene expression. PCBP1 acts as a negative regulator of CD44 variants splicing in HepG2 cells, and loss of PCBP1 in human hepatic tumor contributes to the formation of a metastatic phenotype.

  • Evans,J.R. et al., 2003, Oncogene  22 (39): 8012-20.
  • Huo,L.R. et al., 2008, Biochim Biophys Acta  1784 (11):1524-33.
  • Huo,L.R. et al., 2009, Beijing Da Xue Xue Bao  41 (4):402-8.
  • Zhang,T. et al., 2010, Mol Cancer 9 :72.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human PCBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items