Quick Order

Human TUBB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TUBB cDNA Clone Product Information
Gene_bank_ref_id:NM_178014.2
RefSeq ORF Size:1335bp
cDNA Description:Full length Clone DNA of Homo sapiens tubulin, beta.
Gene Synonym:M40, TUBB1, TUBB5, MGC16435, MGC117247, OK/SW-cl.56, TUBB
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TUBB
Restriction Site:KpnI + NotI (6.1kb + 1.34kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG11626-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"