After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LRRN3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LRRN3 cDNA Clone Product Information
Gene_bank_ref_id:BC035133.2
RefSeq ORF Size:2127bp
cDNA Description:Full length Clone DNA of Homo sapiens leucine rich repeat neuronal 3.
Gene Synonym:NLRR3, NLRR-3, FIGLER5, FLJ11129, LRRN3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-LRRN3
Restriction Site:HindIII + NotI (6.1kb + 2.13kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human LRRN3 Gene Plasmid Map
Human LRRN3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Leucine-rich repeat neuronal protein 3, also known as neuronal leucine-rich repeat protein 3 (NLRR-3), is a member of leucine-rich (LRR) family whose members have significant functions in neural development. Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. All proteins containing these repeats are thought to be involved in protein-protein interactions. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged so that they form a parallel β-sheet with one surface exposed to solvent, so that the protein acquires an unusual, non-globular shape. These two features may be responsible for the protein-binding functions of proteins containing leucine-rich repeats. LRRN3 plays an important role in cerebellum postnatal development. In a unilateral cortical injury cerebral cortex, NLRR-3 mRNA increased in layers 2-3 which suggests that NLRR-3 may be an important component of the pathophysiological response to brain injury. 

References
  • Yang J, et al. (2011) Role of LRRN3 in the cerebellum postnatal development in rats. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36 (5): 424-9.
  • Hutcheson HB, et al. (2004) Examination of NRCAM, LRRN3, KIAA0716, and LAMB1 as autism candidate genes. BMC Med Genet. 5: 12.
  • Ishii N, et al. (1996) Increased expression of NLRR-3 mRNA after cortical brain injury in mouse. Brain Res Mol Brain Res. 40 (1): 148-52.
  • Size / Price
    Catalog: HG11610-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"