Quick Order

Text Size:AAA

Human CSH1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSH1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001317.3
RefSeq ORF Size:654bp
cDNA Description:Full length Clone DNA of Homo sapiens chorionic somatomammotropin hormone 1 (placental lactogen).
Gene Synonym:CSH1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CSH1
Restriction Site:HindIII + NotI (6.1kb + 0.65kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 93 C/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Chorionic somatomammotropin hormone, also known as Choriomammotropin, Lactogen, Placental lactogen and CSH1, is a secreted protein which belongs to the somatotropin / prolactin family. CSH1 is produced only during pregnancy and is involved in stimulating lactation, fetal growth and metabolism. Does not interact with GHR but only activates PRLR through zinc-induced dimerization. The CSH1 gene is member of the GH gene cluster on 17q, which consists of two growth hormone genes and three CSH genes. Genomic alterations in the GH cluster are well known, causing different phenotypes depending on the size of the deletion and the genes involved. The increased prevalence of hemizygosity of CSH1 in population in comparison to controls indicates a role for CSH1 haploinsufficiency in the etiology of growth retardation. Investigation of CSH1 deletions in further SRS and growth retarded patients will enable us to establish under which circumstances haploinsufficiency of CSH1 is likely to result in clinical changes.

References
  • Prager,S. et al., 2003,Genet Test. 7 (3):259-63.
  • Singleton, DR. et al., 2004, Microbiology. 150 (Pt 2): 285-92.
  • Chen,Y. et al., 2008, Cancer Res. 68 (23):9729-34.
  • Size / Price
    Catalog: HG11596-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"