After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LCN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LCN1cDNA Clone Product Information
cDNA Size:531
cDNA Description:ORF Clone of Homo sapiens lipocalin 1 (tear prealbumin) DNA.
Gene Synonym:TP, PMFA, VEGP, MGC71975, LCN1
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Lipocalin-1, also known as Von Ebner gland protein, VEG protein, Tear prealbumin, VEGP, Tear lipocalin and LCN1, is a secreted protein which belongs to the calycin superfamily and Lipocalin family. Human Lipocalin-1 / VEGP was originally described as a major protein of human tear fluid, which was thought to be tear specific. Lipocalin-1 / VEGP is identical with lingual von Ebner's gland protein, and is also produced in prostate, nasal mucosa and tracheal mucosa. Homologous proteins have been found in rat, pig and probably dog and horse. Lipocalin-1 / VEGP is an unusual lipocalin member, because of its high promiscuity for relative insoluble lipids and binding characteristics that differ from other members. Lipocalin-1 / VEGP acts as the principal lipid binding protein in tear fluid, a more general physiological function has to be proposed due to its wide distribution and properties. Lipocalin-1 / VEGP would be ideally suited for scavenging of lipophilic, potentially harmful substances and thus might act as a general protection factor of epithelia. Lipocalin-1 / LCN1 could play a role in taste reception. It could be necessary for the concentration and delivery of sapid molecules in the gustatory system. Lipocalin-1 / LCN1 can bind various ligands, with chemical structures ranging from lipids and retinoids to the macrocyclic antibiotic rifampicin and even to microbial siderophores. It exhibits an extremely wide ligand pocket.

  • Lassagne H. et al., 1993, Exp. Eye Res. 56:605-609.
  • Redl,B. et al., 2000, Biochim Biophys Acta  1482 (1-2):241-8.
  • Wojnar P. et al., 2001, J. Biol. Chem. 276:20206-20212.
  • Wojnar P. et al., 2003, J. Biol. Chem. 278:16209-16215.
  • Breustedt D.A. et al., 2005, J. Biol. Chem. 280:484-493.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human LCN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged