Quick Order

Text Size:AAA

Human MAPK3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAPK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_002746.2
RefSeq ORF Size:1140bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 3.
Gene Synonym:ERK1, PRKM3, P44ERK1, P44MAPK, HS44KDAP, HUMKER1A, MGC20180, MAPK3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MAPK3
Restriction Site:KpnI (two restriction sites) + XbaI (6.10kb + 0.63kb + 0.51kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6G>T and 9G>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MAPK3 Gene Plasmid Map
Human MAPK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11545-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"