Quick Order

Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
STXBP2cDNA Clone Product Information
Gene_bank_ref_id:NM_006949.2
cDNA Size:1782
cDNA Description:ORF Clone of Homo sapiens syntaxin binding protein 2 transcript variant 1 DNA.
Gene Synonym:FHL5, UNC18B, Hunc18b, UNC18-2, pp10122, MUNC18-2, STXBP2
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11538-ACG$345
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11538-ACR$345
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11538-ANG$345
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11538-ANR$345
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11538-CF$315
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11538-CH$315
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11538-CM$315
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11538-CY$315
Human STXBP2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG11538-G$115
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11538-NF$315
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11538-NH$315
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11538-NM$315
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11538-NY$315
Human STXBP2 Gene transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11538-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"