Quick Order

Text Size:AAA

Human NEK7 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human NEK7 cDNA Clone Product Information
NCBI RefSeq:NM_133494.2
RefSeq ORF Size:909bp
cDNA Description:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)-related kinase 7.
Gene Synonym:NEK7
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NEK7
Restriction Site:KpnI + XbaI (6.1kb + 0.91kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NEK7 Gene Plasmid Map
Human NEK7 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

NIMA (never in mitosis gene a)-related kinase 7, NEK7 belongs to the NIMA subfamily, NEK Ser/Thr protein kinase family, protein kinase superfamily. NEKs (NIMA-related kinases) are mammalian serine/threonine (Ser/Thr) protein kinases structurally related to Aspergillus NIMA (Never in Mitosis, gene A), which plays essential roles in mitotic signaling. NEKs share an amino-terminal catalytic domain related to NIMA, an Aspergillus kinase involved in the control of several aspects of mitosis, and divergent carboxyl-terminal tails of varying length. NEKs are commonly referred to as mitotic kinases, although a definitive in vivo verification of this definition is largely missing. Reduction in the activity of NEK7 or its close paralog, NEK6, has previously been shown to arrest cells in mitosis, mainly at metaphase. NEK7 is a regulator of cell division, and reveal it as an essential component for mammalian growth and survival. The intimate connection between tetraploidy, aneuploidy and cancer development suggests that NEK7 deregulation can induce oncogenesis. The endogenous NEK7 protein is enriched at the centrosome in a microtubule-independent manner. Overexpression of wt or kinase-defective NEK7 resulted in cells of rounder appearance, and higher proportions of multinuclear and apoptotic cells.

References
  • Belham C, et al. (2003) A mitotic cascade of NIMA family kinases. Nercc1/Nek9 activates the Nek6 and Nek7 kinases. J Biol Chem. 278(37): 34897-909.
  • Minoguchi S, et al.. (2003) Differential control of the NIMA-related kinases, Nek6 and Nek7, by serum stimulation. Biochem Biophys Res Commun. 301(4): 899-906.
  • Yissachar N, et al. (2006) Nek7 kinase is enriched at the centrosome, and is required for proper spindle assembly and mitotic progression. FEBS Lett. 580(27): 6489-95.
  • Salem H, et al. (2010) Nek7 kinase targeting leads to early mortality, cytokinesis disturbance and polyploidy. Oncogene. 29(28): 4046-57.
  • Size / Price
    Catalog: HG11534-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"