Quick Order

Human STK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
STK4cDNA Clone Product Information
Gene_bank_ref_id:NM_006282.2
cDNA Size:1464
cDNA Description:ORF Clone of Homo sapiens serine/threonine kinase 4 DNA.
Gene Synonym:KRS2, MST1, YSK3, DKFZp686A2068, STK4
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
Catalog:HG11533-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
Images
  • Human STK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"