Quick Order

Text Size:AAA

Human METTL1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human METTL1 cDNA Clone Product Information
NCBI RefSeq:NM_005371.5
RefSeq ORF Size:831bp
cDNA Description:Full length Clone DNA of Homo sapiens methyltransferase like 1.
Gene Synonym:TRM8, C12orf1, YDL201w, FLJ95748, METTL1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-METTL1
Restriction Site:KpnI + XbaI (6.1kb + 0.83kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human METTL1 Gene Plasmid Map
Human METTL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

tRNA (guanine-N(7)-)-methyltransferase, also known as Methyltransferase-like protein 1, tRNA (m7G46)-methyltransferase and METTL1, is a nucleus protein which belongs to the methyltransferase superfamily and TrmB family. METTL1 gene, has been identified by its sequence similarity to the yeast ORF YDL201w. The human cDNA and the genomic structure of METTL1 have been analyzed. The transcript contains 1292 nucleotides and codes for a protein of 276 amino acids. The METTL1 gene product shows high sequence similarities to putative proteins from mouse, Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, and yeast (39.8% identity between all six species). Computer analyses of the deduced protein sequence reveal two highly conserved amino acid motifs, one of which is typical for methyltransferases. Both motifs are also present in hypothetical proteins from eubacteria. Disruption of the homologous yeast ORF YDL201w shows that the gene is at least not essential for vegetative growth in Saccharomyces cerevisiae.

References
  • Bahr, A.et al., 1999, Genomics. 57 (3):424-8.
  • Wikman, H. et al., 2005,Genes Chromosomes Cancer. 42 (2):193-9.
  • Cartlidge, RA. et al., 2005, EMBO J. 24 (9):1696-705.
  • Size / Price
    Catalog: HG11525-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"