Quick Order

Text Size:AAA

Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN9cDNA Clone Product Information
cDNA Size:1782
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, non-receptor type 9 DNA.
Gene Synonym:MEG2, PTPMEG2, PTPN9
Restriction Site:HindⅢ + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11517-ACG$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11517-ACR$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11517-ANG$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11517-ANR$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11517-CF$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11517-CH$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11517-CM$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11517-CY$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone)HG11517-M$115
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11517-M-F$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11517-M-N$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11517-NF$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11517-NH$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11517-NM$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11517-NY$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11517-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged