Quick Order

Human CPSF2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CPSF2 cDNA Clone Product Information
Gene_bank_ref_id:NM_017437.1
RefSeq ORF Size:2349bp
cDNA Description:Full length Clone DNA of Homo sapiens cleavage and polyadenylation specific factor 2, 100kDa.
Gene Synonym:CPSF100, KIAA1367, CPSF2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CPSF2
Restriction Site:KpnI + XbaI (6.1kb + 2.35kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CPSF2 Gene Plasmid Map
Human CPSF2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11512-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"